LaTeX: How to break long words after n chars (long genomic sequences)
I have to include relatively small genomic sequences in a Latex document (still, they are words of around 600-900 As Ts Gs and Cs) but I cannot find a way to force line wrapping after a certain number of characters.
I saw a massive amount of similar topics on the matter, most of them citing listings and discretionaries, but all of the suggested solutions rely on either the small size of the long words to manually add "invisible breakpoints", or the fact that within the words, some special characters (dots, underscores) or patterns, can be defined as breakable areas.
Unfortunately, the sequences I work on are too long to edit manually, and there's no special pattern that can be used within a discretionary.
I'm really at loss of ideas, so if you would have any lead, please share!
Here is an example of sequence that I need to include:
CTCCTTGGGCTGTTATTCCGTAAAAGTATTTGTGGAAGATACGGCTGTCATACATGATATGTTTTTTGTTTATAACAATAGTTCTTTCTTTGATTTCACCATAGGTTGCCTCAAATTGCTCTTTTGTTGCTTGTCCAGCTGTTAAGACTAAATGTTTTGACCCCTCATTTATAAGACCGATTGCGTTGAATGGTAAGACATTCTGTTGTGCTGATTGTAATTCTGAATAGCTACGGATTTTTATGAAGATATAGTTTTTTAATATTGGTATTTCATTCCAGACATACTTCTGTATAAAGGATTTATTAAACGGTGTTGTTTTGATTGCTCTATAATACTTATCTTGTTGTCCTCTTAATTTTACCCAAGGTCTTTCAAACTCTTGGGAGTTAATGATTATAAGCATATTGTAAAGCTGTCCAGCTAATCCGAAGAATACTGGAAGCCAGTGGGTAAAGCTTGTCTGTTTTGGTAAAGCTGTTTGAACGTCTGACAAGAACAAGTCCAGACCTTCATATTTGTGGATTTTTTGAAACTTCATATTTTGATATGAACCGTCTACAATATCACTATATTTTACTGGTTGCCCAGTTTTTTGATTAATGTATCCAGGTCTTTAATATCTACTACTAAAACCACCGTAACCATAGTCCACGTTAGAGATATAGAGAGGTTTCGCATAAATGTGAACCCAGATTGCTTGTTGTTGTCTTTCATAACTCATTTGAAGACCAGTTTTAATGCGTTCTTTAATTGCTTGATACGTT
Best, N.
I have to include relatively small genomic sequences in a Latex document (still, they are words of around 600-900 As Ts Gs and Cs) but I cannot find a way to force line wrapping after a certain number of characters.
I saw a massive amount of similar topics on the matter, most of them citing listings and discretionaries, but all of the suggested solutions rely on either the small size of the long words to manually add "invisible breakpoints", or the fact that within the words, some special characters (dots, underscores) or patterns, can be defined as breakable areas.
Unfortunately, the sequences I work on are too long to edit manually, and there's no special pattern that can be used within a discretionary.
I'm really at loss of ideas, so if you would have any lead, please share!
Here is an example of sequence that I need to include:
CTCCTTGGGCTGTTATTCCGTAAAAGTATTTGTGGAAGATACGGCTGTCATACATGATATGTTTTTTGTTTATAACAATAGTTCTTTCTTTGATTTCACCATAGGTTGCCTCAAATTGCTCTTTTGTTGCTTGTCCAGCTGTTAAGACTAAATGTTTTGACCCCTCATTTATAAGACCGATTGCGTTGAATGGTAAGACATTCTGTTGTGCTGATTGTAATTCTGAATAGCTACGGATTTTTATGAAGATATAGTTTTTTAATATTGGTATTTCATTCCAGACATACTTCTGTATAAAGGATTTATTAAACGGTGTTGTTTTGATTGCTCTATAATACTTATCTTGTTGTCCTCTTAATTTTACCCAAGGTCTTTCAAACTCTTGGGAGTTAATGATTATAAGCATATTGTAAAGCTGTCCAGCTAATCCGAAGAATACTGGAAGCCAGTGGGTAAAGCTTGTCTGTTTTGGTAAAGCTGTTTGAACGTCTGACAAGAACAAGTCCAGACCTTCATATTTGTGGATTTTTTGAAACTTCATATTTTGATATGAACCGTCTACAATATCACTATATTTTACTGGTTGCCCAGTTTTTTGATTAATGTATCCAGGTCTTTAATATCTACTACTAAAACCACCGTAACCATAGTCCACGTTAGAGATATAGAGAGGTTTCGCATAAATGTGAACCCAGATTGCTTGTTGTTGTCTTTCATAACTCATTTGAAGACCAGTTTTAATGCGTTCTTTAATTGCTTGATACGTT
Best, N.
No comments:
Post a Comment